4.6 Describe how the FISHtechnique is used to diagnose Philadelphia Chromosome.
(7)
QUESTION 5:
[23)
Read the passage below and answer the questions that follows.
BRCA1 (BReast CAncer gene 1} and BRCA2 (BReast CAncer gene 2} are genes that produce proteins
that help repair damaged DNA. Everyone has two copies of each of these genes-one copy inherited
from each parent.
People who inherit a harmful change (also called a mutation or pathogenic variant) in one of these
genes have increased risks of several cancers-most notably breast and ovarian cancer, but also
several other types of cancer. People who have inherited a harmful change in BRCAl or BRCA2also
tend to develop cancer at younger ages than people who do not have such a variant.
Nearly everyone who inherits a harmful change in the BRCAl or BRCA2gene from one parent has a
normal second copy of the gene inherited from the other parent. Having one normal copy of either
gene is enough to protect cellsfrom becoming cancer. But the normal copy can change or be lost during
someone's lifetime. Such a change is called a somatic alteration. A cell with a somatic alteration in the
only normal copy of one of these genes doesn't have sufficient DNA repair ability and can become
cancer.
A 32-year-old female with a family history of ovarian and breast cancer visited her doctor to find out
whether she is at risk of developing breast cancer after recently losing her mother to breast cancer.
Below are the results obtained after sequencing BRCAl gene:
CC
TTAAAGAAACAAAGTCCAAA
/\\
!
I,\\(,\\
!v
VIr\\
BRCA 1 gene from non-carrier
CC
TTAAAGACAAAGTCCAAAAG
\\\\. /
BRCA 1 gene from the 32-year-old patient
5.1 Explain the principle of Sanger Sequencing.
(2)
5.2 Interpret the mutation observed above.
(2)
5.3 Using the information above, what advise will you give to the patient?
(2)
5.4 What added value does sequencing have over annual breast examination and
Pap smear?
(2)
5.5 Generate the gel electrophoresis profile for the patient after Sanger Sequencing.
(15)
Molecular Diagnostics (MOD621S)
1st opportunity November 2024
6