![]() |
BIO701S - BIOTECHNOLOGY - 1ST OPP - NOV 2022 |
![]() |
1 Page 1 |
▲back to top |
nAmlBIA unlVERSITY
OF SCIEn CE Ano TECHn OLOGY
FACULTYOF HEALTH,NATURAL RESOURCESAND APPLIEDSCIENCES
DEPARTMENTOF NATURALAND APPLIEDSCIENCES
QUALIFICATION : BACHELOROF SCIENCE
QUALIFICATION CODE: 07BSC
LEVEL: 7
COURSECODE: BIO701S
COURSENAME: BIOTECHNOLOGY
DATE: NOVEMBER 2022
DURATION: 3 HOURS
MARKS: 100
FIRSTOPPORTUNITY EXAMINATION QUESTION PAPER
EXAMINER(S) DR NORMAN MUZHINJI
MODERATOR: DR J. D. UZABAKIRIHO
INSTRUCTIONS
1. All examination RULESapply
2. Answer ALL the questions.
3. Write clearly and neatly.
4. Number the answers clearly.
5. All written work MUST be done in BLUEor BLACKink.
PERMISSIBLEMATERIALS
1. Examination question paper
2. Answering book
THIS QUESTION PAPERCONSISTSOF 4 PAGES(Excluding this front page)
![]() |
2 Page 2 |
▲back to top |
Section A: Multiple choice (lOmarks)
1. Which enzyme is used for gene editing?
A. CRISPR-Cas9
B. DNA ligase
C. Hexokinase
D. Acetyl transferase
2. Which of the following court ruling made DNA patentable?
A. Diamond vs. Chakrabarty
B. Brown vs. Board of Education
C. Scopes monkey trial
D. Roe vs. Wade
3. Which sequence of events occurs in the process of making genetically modified bacteria
A. Extraction of required gene and
Ligating the gene and plasmid
Insertion of plasmid into bacterial cells Growth of transformed bacterial cells
B. Growth of transformed bacterial
Insertion of plasmid into bacterial
Extraction of required gene
C. Insertion of plasmid into bacterial
Growth of transformed bacterial cells
Extraction of required gene
D. Extraction of plasmid into bacterial
Extraction of
Growth of
bacterial cells
4. What enzyme forms covalent bonds between restriction fragments?
A. DNA primase
B. DNA helicase
C. DNA ligase
D. DNA polymerase
5. What are the typical characteristics of a cloning vector?
A. Bacterial cells cannot survive without it when grown under certain conditions.
B. It contains restriction sites that allow the insertion of foreign DNA segments.
C. It can replicate in bacterial cells.
D. All of the above.
6. In order to insert a human gene into plasmid, both must
A. Code for the same gene product.
B. Be cut by the same restriction enzyme.
C. Originate from the same type of cell.
D. Have identical sequences
7. What is the role of Agrobacterium tumefaciens in the production of transgenic plants?
A. Genes from A. tumefaciens are inserted into plant DNA to give the plant different
traits.
B. Transgenic plants have been given resistance to the pest A. tumefaciens.
C. A. tumefaciens is used as a vector to move genes into plant cells.
D. Plant genes are incorporated into the genome of Agrobacterium tumefaciens
![]() |
3 Page 3 |
▲back to top |
8. The process of converting environmental pollutants into harmless products by naturally
occurring microbes is called
A. Exsitu bioremediation
B. Intrinsic bioremediation
C. Extrinsic bioremediation
D. None of the above
9. Which of the following choices best represents the phenotype of a cell containing a
mutation in the Lac I gene?
A Constitutive expression of the lac operon
B No expression of the operon; RNA polymerase cannot bind properly
C Lactose can enter the cell, but cannot be broken down
D Lactose cannot enter the cell
10. Which of the following method would you use to analyse protein expression changes?
A. Agarose gel electrophoresis
B. Western blotting
C. Northern blotting
D. Calcium chloride transformation
![]() |
4 Page 4 |
▲back to top |
SECTION B: Answer all questions (90 Marks)
1. Biotechnology is a recent science gaining functionality only within the past two decades.
State True or False and justify your answer:
(2)
2. Recombinant DNA technology tools and techniques have been copied from nature.
Discuss this statement giving at least five (5) relevant examples
(5)
3. Compare and contrast
a. Recombinant DNA technology and gene editing
(4)
b. In-situ and ex-situ bioremediation
(2)
5. a. Given the sequence below, design the forward and reverse primers, each 18
nucleotides long, which would allow you to generate many copies of a PCRproduct that
was 400 base pairs long.
(2)
GGACCGCGGGGCAGGATTGCTCCGGGCTGTTTCATGACTTGTCAGGTGGG.ri.TGACTTGGATGGAAAAGTAGAAGGTCAT
l +---------+---------+---------+---------+---------+---------+---------+------
CCTGGCGCCCCGTCCTAACGAGGCCCGACAAAGTACTGAACAGTCCACCCTACTGAACCTACCTTTTCATCTTCCAGTAC
GGGTGGCCAACTTGGGCGAGAAAAGGTATATAAAGGTCTCTTGCTCCCATCAACTGCCTCA.I\\.AAGTAGGTATTCCAGCA
81 +---------+---------+---------+---------:---------+---------+---------+-------
CCCACCGGTTGAACCCGCTCTTTTCCATATATTTCCAGAGAACGAGGGTAGTTGACC-C-AGTTTTCATCCATA.ri.GGTCGT
ATCAGACAACGTCAC-C-TGGGAGGACTTGGACGGAfl_ri._ri_c-TAGAAGGTCAAGACCAACCTCT.r.iT.CCCCAACAATACAC.C.A
161 +---------+---------+---------+---------+---------+---------+---------+------
TAGTCTGTTGCAGTCCACCCTCCTGAACCTGCCTTTTCATCTTCCAGTTCTGGTTGGAGA.~GGTTAGGTTGGTGTTTGTT
AAAATCAGCCAATATGTCCGACTTCGAGAACAAGAACCCCAACAACGTCCTTGGCGGACACA.ri.GGCCACCCTTCACAAC
241 +---------+---------+---------+---------+---------+---------+---------+------
TTTTAGTCGGTTATACAGGCTGAAGCTCTTGTTCTTGC-C-GTTGTTGCAGGAACCGCCTGTGTTCCGGTGGGAAGTGTTC-
CTAGTATGTATCCTCCTCAGAGCCTCCAGCTTCCGTCCCTCGTCGACATTTCCTTT-TTTTTCATATTACATCCATCCAJI.G
321 +---------+---------+---------+---------+---------+---------+---------+------
GATCATACATAGGAGGAGTCTCGGAGGTCGAAGGCAGGGAGCAGCTGTAAAGGAA.l\\AAAAAGTATAATGTAC-C-TAGGT
b. What is the function of primers?
(2)
c. After you have designed your primers, you want to use them in a PCRreaction.
What is a polymerase chain reaction? What are the steps involved? Mention its
applications.
(10)
d. Now, you want to view the DNA that you have PCRamplified using gel
electrophoresis, explain how you would prepare 150 mis of 3% agarose gel for doing
your electrophoresis?
(2)
e. You run your DNA fragments on an ethidium bromide-stained agarose gel, but no
bands were observed. What do you think would be the cause?
(3)
![]() |
5 Page 5 |
▲back to top |
6. Eva-Lisa, a scientist at the Biotechnology Research Center digested a pUC19 plasmid using
EcoR1 and Hindlll, both enzymes are super imposed together i.e. double digest. Using the
information on the table below.
Restriction enzyme
Number of base pair per band
EcoR1
30
I 1s
Is
Hind Ill
so
EcoR1 +Hind 111
20
I 1s
I 10
/s
Using a well labelled diagram, show where these enzymes cut the plasmid.
(8)
7. Resurrecting plant is an extraordinary plant, that can survive in the hot, dry desert where
other plants can't survive. On the other hand, food crops have little to no drought
resistance or tolerance. The Minister of Agriculture, Water and Forestry has hypothesized
that putting resurrecting plant's survival skills into maize will make it drought tolerant and
expand cultivation of maize to marginal arid areas of Namibia.
Imagine, you have been engaged by the Minister of Agriculture, Water and Forestry as a
scientist to make use of the Resurrecting plant surviving skills to develop a maize variety
that is drought tolerant,
a. With the aid of a diagram, detail all the steps to the Minister on how you would intend
to come up with such a maize variety
(17)
b. Mention any three vector-less methods that you can use to introduce recombinant
DNA into a competent host cell.
(6)
8. A gene was being ligated to the plasmid vector to prepare a recombinant DNA during
bacterial transformation. An exonuclease was added to the tube accidentally. How will it
affect the next step of the experiment?
(2)
9. The development of genetically engineered plants has been a topic of debate for over
three decades now. Describe the benefits, advantages of developing GMO crops and detail
how you can mitigate the risks posed by GMO crops?
(15)
10. Write short notes on
i. Terminator gene technology
(2)
ii. The Cartagena Protocol on Biosafety
(3)
iii. Central Dogma of Molecular Biology
(3)
iv. Gene therapy
(2)
![]() |
6 Page 6 |
▲back to top |






